Skip to main content

pAAV-GFAP-jGCaMP7c variant 1513
(Plasmid #173159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173159 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV-GFAP-EGFP
  • Backbone size w/o insert (bp) 4764
  • Total vector size (bp) 6118
  • Modifications to backbone
    EcoRI site was removed upon cloning
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    jGCaMP7c variant 1513-WPRE
  • Alt name
    Janelia GCaMP7
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria
  • Insert Size (bp)
    1353
  • GenBank ID
    MK749394
  • Promoter GFAP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer TCATAAAGCCCTCGCATCCC
  • 3′ sequencing primer AGCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The gene jGCaMP7c comes from Addgene plasmid #105321.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-GFAP-jGCaMP7c variant 1513 was a gift from Hervé Chneiweiss & Vincent Vialou (Addgene plasmid # 173159 ; http://n2t.net/addgene:173159 ; RRID:Addgene_173159)