Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKD280.7
(Plasmid #173172)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173172 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p15A
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SO_4387
  • Species
    Shewanella oneidensis
  • Promoter J23107

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGGTATCAGCTCACTCAAAGG
  • 3′ sequencing primer GCCTGCAGGTCGACTCTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKD280.7 was a gift from Jeffrey Tabor (Addgene plasmid # 173172 ; http://n2t.net/addgene:173172 ; RRID:Addgene_173172)
  • For your References section:

    Mucosal acidosis elicits a unique molecular signature in epithelia and intestinal tissue mediated by GPR31-induced CREB phosphorylation. Cartwright IM, Dowdell AS, Lanis JM, Brink KR, Mu A, Kostelecky RE, Schaefer REM, Welch N, Onyiah JC, Hall CHT, Gerich ME, Tabor JJ, Colgan SP. Proc Natl Acad Sci U S A. 2021 May 18;118(20). pii: 2023871118. doi: 10.1073/pnas.2023871118. 10.1073/pnas.2023871118 PubMed 33972436
Commonly requested with: