pKD280.7
(Plasmid
#173172)
-
PurposeExpresses SO_4387
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep15A
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSO_4387
-
SpeciesShewanella oneidensis
- Promoter J23107
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGGTATCAGCTCACTCAAAGG
- 3′ sequencing primer GCCTGCAGGTCGACTCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKD280.7 was a gift from Jeffrey Tabor (Addgene plasmid # 173172 ; http://n2t.net/addgene:173172 ; RRID:Addgene_173172) -
For your References section:
Mucosal acidosis elicits a unique molecular signature in epithelia and intestinal tissue mediated by GPR31-induced CREB phosphorylation. Cartwright IM, Dowdell AS, Lanis JM, Brink KR, Mu A, Kostelecky RE, Schaefer REM, Welch N, Onyiah JC, Hall CHT, Gerich ME, Tabor JJ, Colgan SP. Proc Natl Acad Sci U S A. 2021 May 18;118(20). pii: 2023871118. doi: 10.1073/pnas.2023871118. 10.1073/pnas.2023871118 PubMed 33972436