pM198
(Plasmid
#173218)
-
PurposeExpresses OptGFP(1-9)-GB1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHAGE-DEST
- Backbone size w/o insert (bp) 6479
- Total vector size (bp) 7418
-
Modifications to backbone2xTet0 deletion
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameOptGFP(1-9)
-
SpeciesSynthetic
-
Insert Size (bp)939
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI, EcoRI, BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tgtacggtgggaggtctata
- 3′ sequencing primer agttaagaataccagtcaatctttcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM198 was a gift from Hajin Kim (Addgene plasmid # 173218 ; http://n2t.net/addgene:173218 ; RRID:Addgene_173218) -
For your References section:
Background-suppressed live visualization of genomic loci with an improved CRISPR system based on a split fluorophore. Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H. Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4. 10.1101/gr.260018.119 PubMed 32887690