Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPBT-PE2-PuroTK-pegRNA_GG
(Plasmid #173222)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pPBT
  • Total vector size (bp) 14039
  • Vector type
    Mammalian Expression ; piggyBac
  • Selectable markers
    Puromycin ; PuroTK

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PE2
  • Alt name
    Prime editor 2
  • Alt name
    SpCas9(H840A)-M-MLV-RT
  • Species
    Synthetic
  • Insert Size (bp)
    6351
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCAAAATGTCGTAACAACTCCGCCC
  • 3′ sequencing primer GCGGTCCGGATCGACGGTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PuroTK
  • Insert Size (bp)
    1568
  • Promoter P2A

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCCGGAGATGTCGAAGAGAA
  • 3′ sequencing primer CTCAGACAATGCGATGCAAT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    pegRNA cloning cassette
  • Alt name
    pegRNA-GG-acceptor (BsmBI)
  • Insert Size (bp)
    678
  • Promoter hU6

Cloning Information for Gene/Insert 3

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPBT-PE2-PuroTK-pegRNA_GG was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 173222 ; http://n2t.net/addgene:173222 ; RRID:Addgene_173222)
  • For your References section:

    piggyPrime: High-Efficacy Prime Editing in Human Cells Using piggyBac-Based DNA Transposition. Wolff JH, Haldrup J, Thomsen EA, Andersen S, Mikkelsen JG. Front Genome Ed. 2021 Nov 12;3:786893. doi: 10.3389/fgeed.2021.786893. eCollection 2021. 10.3389/fgeed.2021.786893 PubMed 34870275