pT7-RiboJ-mTFP1-T7
(Plasmid
#173225)
-
PurposeEncodes mTFP fluorescent protein. To be used in cell-free system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUCIDT-KAN
-
Backbone manufacturerIDT
- Total vector size (bp) 3865
-
Vector typeBacterial Expression ; Cell-Free system
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemTFP1
-
SpeciesE coli
-
Insert Size (bp)734
-
GenBank IDDQ676819.1
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATTACTCGCATCCATTCTCAGGCTGTCTCGTCTCGTCTC
- 3′ sequencing primer GGTGGAAGGGCTCGGAGTTGTGGTAATCTATGTATCCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT7-RiboJ-mTFP1-T7 was a gift from Jim Haseloff (Addgene plasmid # 173225 ; http://n2t.net/addgene:173225 ; RRID:Addgene_173225) -
For your References section:
Constructing Cell-Free Expression Systems for Low-Cost Access. Guzman-Chavez F, Arce A, Adhikari A, Vadhin S, Pedroza-Garcia JA, Gandini C, Ajioka JW, Molloy J, Sanchez-Nieto S, Varner JD, Federici F, Haseloff J. ACS Synth Biol. 2022 Mar 18;11(3):1114-1128. doi: 10.1021/acssynbio.1c00342. Epub 2022 Mar 8. 10.1021/acssynbio.1c00342 PubMed 35259873