Skip to main content

HC-M
(Plasmid #173481)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173481 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJF72
  • Total vector size (bp) 3033
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Ampicillin selection is 100 ug/ml. Carbenicillin selection is 50 ug/ml. The recommended strain for expression is BL21(DE3).
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP-mut2
  • Alt name
    mutated fast-folding GFP
  • Promoter rrnB P1
  • Tag / Fusion Protein
    • ssrA degradation tag

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggttattgtctcatgagcgga
  • 3′ sequencing primer ggcggatttgtcctactcagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HC-M was a gift from Rahul Sarpeshkar (Addgene plasmid # 173481 ; http://n2t.net/addgene:173481 ; RRID:Addgene_173481)
  • For your References section:

    Measuring and modeling energy and power consumption in living microbial cells with a synthetic ATP reporter. Deng Y, Beahm DR, Ionov S, Sarpeshkar R. BMC Biol. 2021 May 17;19(1):101. doi: 10.1186/s12915-021-01023-2. 10.1186/s12915-021-01023-2 PubMed 34001118