-
PurposeAn rrnB P1-based GFP ATP reporter in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173481 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJF72
- Total vector size (bp) 3033
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAmpicillin selection is 100 ug/ml. Carbenicillin selection is 50 ug/ml. The recommended strain for expression is BL21(DE3).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-mut2
-
Alt namemutated fast-folding GFP
- Promoter rrnB P1
-
Tag
/ Fusion Protein
- ssrA degradation tag
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggttattgtctcatgagcgga
- 3′ sequencing primer ggcggatttgtcctactcagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HC-M was a gift from Rahul Sarpeshkar (Addgene plasmid # 173481 ; http://n2t.net/addgene:173481 ; RRID:Addgene_173481) -
For your References section:
Measuring and modeling energy and power consumption in living microbial cells with a synthetic ATP reporter. Deng Y, Beahm DR, Ionov S, Sarpeshkar R. BMC Biol. 2021 May 17;19(1):101. doi: 10.1186/s12915-021-01023-2. 10.1186/s12915-021-01023-2 PubMed 34001118