pClgn1.1_3xFLAG-Kctd19
(Plasmid
#173498)
-
PurposeExpress 3xFLAG-Kctd19 under the mouse Clgn promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepClgn1.1
- Backbone size w/o insert (bp) 3793
- Total vector size (bp) 6634
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePotassium Channel Tetramerization Domain Containing 19
-
Alt nameKctd19
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2877
-
Entrez GeneKctd19 (a.k.a. 4922504H04Rik)
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TTGAGCGGGCCGCTTGCGCACTGG
- 3′ sequencing primer gccacaccagccaccaccttctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClgn1.1_3xFLAG-Kctd19 was a gift from Masahito Ikawa (Addgene plasmid # 173498 ; http://n2t.net/addgene:173498 ; RRID:Addgene_173498) -
For your References section:
KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. Oura S, Koyano T, Kodera C, Horisawa-Takada Y, Matsuyama M, Ishiguro KI, Ikawa M. PLoS Genet. 2021 May 7;17(5):e1009412. doi: 10.1371/journal.pgen.1009412. eCollection 2021 May. 10.1371/journal.pgen.1009412 PubMed 33961623