Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pClgn1.1_3xFLAG-Kctd19
(Plasmid #173498)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173498 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pClgn1.1
  • Backbone size w/o insert (bp) 3793
  • Total vector size (bp) 6634
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Potassium Channel Tetramerization Domain Containing 19
  • Alt name
    Kctd19
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2877
  • Entrez Gene
    Kctd19 (a.k.a. 4922504H04Rik)
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TTGAGCGGGCCGCTTGCGCACTGG
  • 3′ sequencing primer gccacaccagccaccaccttctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClgn1.1_3xFLAG-Kctd19 was a gift from Masahito Ikawa (Addgene plasmid # 173498 ; http://n2t.net/addgene:173498 ; RRID:Addgene_173498)
  • For your References section:

    KCTD19 and its associated protein ZFP541 are independently essential for meiosis in male mice. Oura S, Koyano T, Kodera C, Horisawa-Takada Y, Matsuyama M, Ishiguro KI, Ikawa M. PLoS Genet. 2021 May 7;17(5):e1009412. doi: 10.1371/journal.pgen.1009412. eCollection 2021 May. 10.1371/journal.pgen.1009412 PubMed 33961623