Skip to main content
Addgene

pClgn1.1
(Plasmid #173686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173686 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBluescript SKII (+)
  • Backbone manufacturer
    Stratagene
  • Vector type
    Mammalian Expression
  • Promoter mouse Clgn promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer agcggataacaatttcacacaggaaac
  • 3′ sequencing primer cgccagggttttcccagtcacgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClgn1.1 was a gift from Masahito Ikawa (Addgene plasmid # 173686 ; http://n2t.net/addgene:173686 ; RRID:Addgene_173686)
  • For your References section:

    Calmegin is required for fertilin alpha/beta heterodimerization and sperm fertility. Ikawa M, Nakanishi T, Yamada S, Wada I, Kominami K, Tanaka H, Nozaki M, Nishimune Y, Okabe M. Dev Biol. 2001 Dec 1;240(1):254-61. doi: 10.1006/dbio.2001.0462. 10.1006/dbio.2001.0462 PubMed 11784061