Skip to main content

pITGA5_473G>A
(Plasmid #173811)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173811 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC-GW-Kan
  • Backbone manufacturer
    Genewiz
  • Backbone size w/o insert (bp) 2626
  • Total vector size (bp) 2727
  • Vector type
    Mammalian Expression
  • Selectable markers
    kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NT473 ITGA5 point mutation
  • Alt name
    NM_002205.5
  • gRNA/shRNA sequence
    TGGAGTACAAGTCCTTGCAG
  • Species
    H. sapiens (human)
  • GenBank ID
    3678
  • Entrez Gene
    ITGA5 (a.k.a. CD49e, FNRA, VLA-5, VLA5A)
  • Promoter AmpR

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGGAGTACTAGAGGGAGAGG
  • 3′ sequencing primer ATCTGTGGAGAGGTAGCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Genewiz, Inc.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pITGA5_473G>A was a gift from Andrew M. Siedlecki (Addgene plasmid # 173811 ; http://n2t.net/addgene:173811 ; RRID:Addgene_173811)
  • For your References section:

    Integrin alpha5 Is Regulated by miR-218-5p in Endothelial Progenitor Cells. Liu J, Li Y, Lyu L, Xiao L, Memon AA, Yu X, Halim A, Patel S, Osman A, Yin W, Jiang J, Naini S, Lim K, Zhang A, Williams JD, Koester R, Qi KZ, Fucci QA, Ding L, Chang S, Patel A, Mori Y, Chaudhari A, Bao A, Liu J, Lu TS, Siedlecki A. J Am Soc Nephrol. 2022 Mar;33(3):565-582. doi: 10.1681/ASN.2021020140. Epub 2022 Jan 28. 10.1681/ASN.2021020140 PubMed 35091451