Skip to main content

mVenus-NES-SspB-C3Gcat-P2A-iLIDcaax
(Plasmid #173868)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173868 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3946
  • Total vector size (bp) 6859
  • Modifications to backbone
    EGFP was removed
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mVenus-NES-SspB-C3Gcat-P2A-iLIDcaax
  • Species
    H. sapiens (human); Avena sativa (oat)
  • Insert Size (bp)
    2913
  • GenBank ID
  • Promoter CMV
  • Tags / Fusion Proteins
    • mVenus (N terminal on insert)
    • C-terminal CAAX-box (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTCTATATAAGCAGAGCTGG
  • 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mVenus-NES-SspB-C3Gcat-P2A-iLIDcaax was a gift from Takao Nakata (Addgene plasmid # 173868 ; http://n2t.net/addgene:173868 ; RRID:Addgene_173868)
  • For your References section:

    Optogenetic control of small GTPases reveals RhoA mediates intracellular calcium signaling. Inaba H, Miao Q, Nakata T. J Biol Chem. 2021 Jan-Jun;296:100290. doi: 10.1016/j.jbc.2021.100290. Epub 2021 Jan 13. 10.1016/j.jbc.2021.100290 PubMed 33453281