mCherry-NES-SspB-SOS2cat-P2A-iLIDcaax
(Plasmid
#173873)
-
PurposeMammalian expression of mCherry-NES-SspB-SOS2cat-P2A-iLIDcaax (opto-Ras)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3946
- Total vector size (bp) 7135
-
Modifications to backboneEGFP was removed
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry-NES-SspB-SOS2cat-P2A-iLIDcaax
-
SpeciesH. sapiens (human); Avena sativa (oat)
-
Insert Size (bp)3189
-
GenBank ID
- Promoter CMV
-
Tags
/ Fusion Proteins
- mCherry (N terminal on insert)
- C-terminal CAAX-box (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTCTATATAAGCAGAGCTGG
- 3′ sequencing primer AAGTAAAACCTCTACAAATGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-NES-SspB-SOS2cat-P2A-iLIDcaax was a gift from Takao Nakata (Addgene plasmid # 173873 ; http://n2t.net/addgene:173873 ; RRID:Addgene_173873) -
For your References section:
Optogenetic control of small GTPases reveals RhoA mediates intracellular calcium signaling. Inaba H, Miao Q, Nakata T. J Biol Chem. 2021 Jan-Jun;296:100290. doi: 10.1016/j.jbc.2021.100290. Epub 2021 Jan 13. 10.1016/j.jbc.2021.100290 PubMed 33453281