Skip to main content

pUFlip-floxed2A-KalTA4-; gcry1:BFP -2
(Plasmid #173891)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173891 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pK
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2730
  • Total vector size (bp) 7495
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2A-KalTA4; gcry1: BFP
  • Alt name
    P2A-monomeric KalTA4 gamma crystallin 1: BFP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    4765

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note PacCI sites have replaced the BfuAI sites within the initial versions of these vectors created by the Essner lab.

Please visit https://www.biorxiv.org/content/10.1101/2021.06.18.448732v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUFlip-floxed2A-KalTA4-; gcry1:BFP -2 was a gift from Jeffrey Essner (Addgene plasmid # 173891 ; http://n2t.net/addgene:173891 ; RRID:Addgene_173891)
  • For your References section:

    Cre/lox regulated conditional rescue and inactivation with zebrafish UFlip alleles generated by CRISPR-Cas9 targeted integration. Liu F, Kambakam S, Almeida MP, Ming Z, Welker JM, Wierson WA, Schultz-Rogers LE, Ekker SC, Clark KJ, Essner JJ, McGrail M. Elife. 2022 Jun 17;11. pii: 71478. doi: 10.7554/eLife.71478. 10.7554/eLife.71478 PubMed 35713402