pSBtet-RB-PE2
(Plasmid
#173903)
-
PurposeSB-transposon with inducible expression of SpCas9 PE2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 173903 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSBtet-RB
-
Backbone manufacturerKowarz Lab (Addgene Plasmid #60506)
- Backbone size w/o insert (bp) 2021
- Total vector size (bp) 8375
-
Modifications to backbonePE2 inserted between SfiI restriction sites
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePE2
-
Alt nameCas9(H840A)-M-MLVrt(D200N, T306K, W313F, T330P, L603W)
-
SpeciesSynthetic
-
Insert Size (bp)6354
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on backbone)
- SV40 NLS (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
- 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPE2 insert was cloned from pCMV-PE2 (Addgene Plasmid #132775)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-RB-PE2 was a gift from Ronald Cohn (Addgene plasmid # 173903 ; http://n2t.net/addgene:173903 ; RRID:Addgene_173903)