Skip to main content

pGL3-noSV40-humanEC1.45_p300peak1-2_del10
(Plasmid #173982)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173982 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3-Promoter, GenBank: U47298.2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5016
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p300 peak 1 and peak 2 from SOX9 enhancer cluster EC1.45 with tiled deletion #10
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1458
  • Mutation
    Tiled deletion #10
  • Promoter SV40 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CGCTCTCCATCAAAACAAAACG
  • 3′ sequencing primer GAGTTAGGGGCGGGATGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-noSV40-humanEC1.45_p300peak1-2_del10 was a gift from Joanna Wysocka (Addgene plasmid # 173982 ; http://n2t.net/addgene:173982 ; RRID:Addgene_173982)
  • For your References section:

    Loss of Extreme Long-Range Enhancers in Human Neural Crest Drives a Craniofacial Disorder. Long HK, Osterwalder M, Welsh IC, Hansen K, Davies JOJ, Liu YE, Koska M, Adams AT, Aho R, Arora N, Ikeda K, Williams RM, Sauka-Spengler T, Porteus MH, Mohun T, Dickel DE, Swigut T, Hughes JR, Higgs DR, Visel A, Selleri L, Wysocka J. Cell Stem Cell. 2020 Nov 5;27(5):765-783.e14. doi: 10.1016/j.stem.2020.09.001. Epub 2020 Sep 28. 10.1016/j.stem.2020.09.001 PubMed 32991838