pUC19-pleCopyCatcher
(Plasmid
#174061)
-
PurposeCopyCatcher insertion donor for the pale locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePale
-
Alt nameSA-T2A-DsRed-Pale gRNA-mCerulean
-
gRNA/shRNA sequenceGAAGTCCGTGTTAGTGACACTGG
-
SpeciesD. melanogaster (fly), Synthetic
-
Entrez GenePale
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-pleCopyCatcher was a gift from Ethan Bier (Addgene plasmid # 174061 ; http://n2t.net/addgene:174061 ; RRID:Addgene_174061) -
For your References section:
CopyCatchers are versatile active genetic elements that detect and quantify inter-homolog somatic gene conversion. Li Z, Marcel N, Devkota S, Auradkar A, Hedrick SM, Gantz VM, Bier E. Nat Commun. 2021 May 11;12(1):2625. doi: 10.1038/s41467-021-22927-1. 10.1038/s41467-021-22927-1 PubMed 33976171