pJL30
(Plasmid
#174064)
-
PurposeEncodes for 43-8 ZF fused to Cry2. Used for optogenetic recruitment of TF. Used with pJL32.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174064 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepGal1-TetO-3xNLS-43-8ZF-Cry2-tADH1
-
SpeciesS. cerevisiae (budding yeast), A. thaliana (mustard weed), Synthetic
- Promoter pGal1
-
Tag
/ Fusion Protein
- FLAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (unknown if destroyed)
- 3′ cloning site MluI (unknown if destroyed)
- 5′ sequencing primer ccaagaaaaagaggaaggtgggca
- 3′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byennedy, M.J., Hughes, R.M., Peteya, L.A., Schwartz, J.W., Ehlers, M.D., and Tucker, C.L. (2010). Rapid blue-light-mediated induction of protein interactions in living cells. Nature Methods 7, 973-U948. 10.1038/nmeth.1524. and Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.
Please note: Plasmid contains E10G and N257D mutations in URA3. These mutations are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL30 was a gift from Albert Keung (Addgene plasmid # 174064 ; http://n2t.net/addgene:174064 ; RRID:Addgene_174064) -
For your References section:
Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745