Skip to main content
Addgene

pJL45
(Plasmid #174067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pGal1-LacO-3NLS-CIB1-tADH1
  • Species
    S. cerevisiae (budding yeast), A. thaliana (mustard weed), Synthetic
  • Promoter pGal1
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (unknown if destroyed)
  • 3′ cloning site SpfI (unknown if destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer catcgcgttaattaatagacaactc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Kennedy, M.J., Hughes, R.M., Peteya, L.A., Schwartz, J.W., Ehlers, M.D., and Tucker, C.L. (2010). Rapid blue-light-mediated induction of protein interactions in living cells. Nature Methods 7, 973-U948. 10.1038/nmeth.1524. and Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2021.01.05.425451v1 for bioRxiv preprint.

Please note: Plasmid contains a 217bp insertion in the backbone downstream of the Tadh1 terminator. This insertion does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL45 was a gift from Albert Keung (Addgene plasmid # 174067 ; http://n2t.net/addgene:174067 ; RRID:Addgene_174067)
  • For your References section:

    Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745