Skip to main content

pJL50
(Plasmid #174068)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174068 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pTEF1-3NLS-97-3ZF-VP16
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Promoter pTEF1
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer unknown
  • 3′ sequencing primer catcgcgttaattaatagacaactc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Keung, A.J., Bashor, C.J., Kiriakov, S., Collins, J.J., and Khalil, A.S. (2014). Using Targeted Chromatin Regulators to Engineer Combinatorial and Spatial Transcriptional Regulation. Cell 158, 110-120. 10.1016/j.cell.2014.04.047.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJL50 was a gift from Albert Keung (Addgene plasmid # 174068 ; http://n2t.net/addgene:174068 ; RRID:Addgene_174068)
  • For your References section:

    Mapping the dynamic transfer functions of eukaryotic gene regulation. Lee JB, Caywood LM, Lo JY, Levering N, Keung AJ. Cell Syst. 2021 Aug 24. pii: S2405-4712(21)00291-X. doi: 10.1016/j.cels.2021.08.003. 10.1016/j.cels.2021.08.003 PubMed 34469745