pHR: pPGK PYL1-sfGFP-NLS
(Plasmid
#174116)
-
PurposeExpression of PYL1-sfGFP-NLS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePYL1-sfGFP-NLS
- Promoter PGK
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATTCTGCACGCTTCAAAAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR: pPGK PYL1-sfGFP-NLS was a gift from Stanley Qi (Addgene plasmid # 174116 ; http://n2t.net/addgene:174116 ; RRID:Addgene_174116) -
For your References section:
Interrogation of the dynamic properties of higher-order heterochromatin using CRISPR-dCas9. Gao Y, Han M, Shang S, Wang H, Qi LS. Mol Cell. 2021 Aug 13. pii: S1097-2765(21)00612-2. doi: 10.1016/j.molcel.2021.07.034. 10.1016/j.molcel.2021.07.034 PubMed 34428454