pHR: pmU6 sgChr13q34 2xMS2 pUbC MCP-mCherry-p2a-Puro
(Plasmid
#174119)
-
PurposeExpression of sgRNA targeting Chr13q34 (chr13: 112277011 - 112319170, hg38)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgChr13q34 2xMS2 and MCP-mCherry-p2a-Puro
-
gRNA/shRNA sequenceACCATTCCTTC
- Promoter mU6 and UbC
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cagcacaaaaggaaactcacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR: pmU6 sgChr13q34 2xMS2 pUbC MCP-mCherry-p2a-Puro was a gift from Stanley Qi (Addgene plasmid # 174119 ; http://n2t.net/addgene:174119 ; RRID:Addgene_174119) -
For your References section:
Interrogation of the dynamic properties of higher-order heterochromatin using CRISPR-dCas9. Gao Y, Han M, Shang S, Wang H, Qi LS. Mol Cell. 2021 Aug 13. pii: S1097-2765(21)00612-2. doi: 10.1016/j.molcel.2021.07.034. 10.1016/j.molcel.2021.07.034 PubMed 34428454