pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-427-WPRE
(Plasmid
#174135)
-
PurposepAAV plasmid expressing an mCherry.3xFLAG.NOS1AP396-427 fusion protein under the hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5339
- Total vector size (bp) 5442
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNos1ap
-
Alt nameCAPON
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)103
-
MutationOnly contains the sequences coding for amino acids 396-427
-
GenBank IDNM_001109985
-
Entrez GeneNos1ap (a.k.a. 6330408P19Rik, Capon)
- Promoter hSyn
-
Tags
/ Fusion Proteins
- mCherry (N terminal on backbone)
- 3xFLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was obtained from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976). mCherry was amplified by PCR from pAAV-hSyn-hChR2(H134R)-mCherry, a gift from Karl Deisseroth (Addgene plasmid # 26976).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-mCherry.3xFLAG.NOS1AP396-427-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 174135 ; http://n2t.net/addgene:174135 ; RRID:Addgene_174135) -
For your References section:
Hippocampal overexpression of NOS1AP promotes endophenotypes related to mental disorders. Freudenberg F, Candemir E, Chen X, Li LL, Esen-Sehir D, Schenk N, Kinoshita M, Grunewald L, Frerichs V, Fattakhov N, Manchen J, Bikas S, Kumar A, OLeary A, Slattery DA, von Engelhardt J, Courtney MJ, Reif A. EBioMedicine. 2021 Aug 26;71:103565. doi: 10.1016/j.ebiom.2021.103565. 10.1016/j.ebiom.2021.103565 PubMed 34455393