Skip to main content
Addgene

pCm N-term SMT3 NikJC199U
(Plasmid #174210)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174210 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCm N-term-SMT3
  • Backbone size w/o insert (bp) 3822
  • Total vector size (bp) 5184
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
  • Species
    Streptomyces tendae
  • Insert Size (bp)
    1362
  • Mutation
    C199U
  • GenBank ID
    CAC80908.1
  • Promoter T7
  • Tags / Fusion Proteins
    • SMT3 (N terminal on backbone)
    • 8xHis (C terminal on backbone)
    • TEV (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatataccatgagcactagtgactcagaagtcaatcaag
  • 3′ sequencing primer gtttccctgTGCCGGACGCAGGGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    NikJ gene was a gift from Dr. Kenichi Yokoyama, Department of biochemistry, Duke University medical Center, Durham, north Carolina, USA. Department of Chemistry, Duke University, Durham, north Carolina, USA. *e-mail: [email protected]

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCm N-term SMT3 NikJC199U was a gift from Brandon Greene (Addgene plasmid # 174210 ; http://n2t.net/addgene:174210 ; RRID:Addgene_174210)
  • For your References section:

    Selenocysteine substitutions in thiyl radical enzymes. Caceres JC, Bailey CA, Yokoyama K, Greene BL. Methods Enzymol. 2022;662:119-141. doi: 10.1016/bs.mie.2021.10.014. Epub 2021 Dec 7. 10.1016/bs.mie.2021.10.014 PubMed 35101207