Skip to main content

pAPM-miR30-DDX1-ts3
(Plasmid #174234)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAPM-miR30
  • Vector type
    Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DDX1 shRNA
  • gRNA/shRNA sequence
    TACTCTTGAACAGTAGGTGCCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    DDX1 (a.k.a. DBP-RB, UKVH5d)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.11.17.567619 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAPM-miR30-DDX1-ts3 was a gift from Jeremy Luban (Addgene plasmid # 174234 ; http://n2t.net/addgene:174234 ; RRID:Addgene_174234)
  • For your References section:

    IFIH1 (MDA5) is required for innate immune detection of intron-containing RNA expressed from the HIV-1 provirus. Guney MH, Nagalekshmi K, McCauley SM, Carbone C, Aydemir O, Luban J. Proc Natl Acad Sci U S A. 2024 Jul 16;121(29):e2404349121. doi: 10.1073/pnas.2404349121. Epub 2024 Jul 10. 10.1073/pnas.2404349121 PubMed 38985764