pAPM-miR30-DHX58-ts1
(Plasmid
#174244)
-
PurposeDHX58 knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174244 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAPM-miR30
-
Vector typeLentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHX58 shRNA
-
gRNA/shRNA sequenceAATAGAAGTGGCCTTGGTAGGG
-
SpeciesH. sapiens (human)
-
Entrez GeneDHX58 (a.k.a. D11LGP2, D11lgp2e, LGP2, RLR-3)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.11.17.567619 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAPM-miR30-DHX58-ts1 was a gift from Jeremy Luban (Addgene plasmid # 174244 ; http://n2t.net/addgene:174244 ; RRID:Addgene_174244) -
For your References section:
IFIH1 (MDA5) is required for innate immune detection of intron-containing RNA expressed from the HIV-1 provirus. Guney MH, Nagalekshmi K, McCauley SM, Carbone C, Aydemir O, Luban J. Proc Natl Acad Sci U S A. 2024 Jul 16;121(29):e2404349121. doi: 10.1073/pnas.2404349121. Epub 2024 Jul 10. 10.1073/pnas.2404349121 PubMed 38985764