Skip to main content

pCm N-term MBP SMT3 NikJC199U
(Plasmid #174363)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174363 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCm N-term MBP SMT3
  • Backbone size w/o insert (bp) 4968
  • Total vector size (bp) 6330
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
  • Species
    Streptomyces tendae
  • Insert Size (bp)
    1362
  • Mutation
    C199U
  • GenBank ID
    CAC80908.1
  • Promoter T7
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • SMT3 (N terminal on backbone)
    • TEV (C terminal on backbone)
    • 8xHis (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttccctgTGCCGGACGCAGGGC
  • 3′ sequencing primer cctcgggagcactagtgactcagaagtcaatcaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NikJ gene was a gift from Dr. Kenichi Yokoyama, Department of biochemistry, Duke University medical Center, Durham, north Carolina, USA. Department of Chemistry, Duke University, Durham,

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCm N-term MBP SMT3 NikJC199U was a gift from Brandon Greene (Addgene plasmid # 174363 ; http://n2t.net/addgene:174363 ; RRID:Addgene_174363)
  • For your References section:

    Selenocysteine substitutions in thiyl radical enzymes. Caceres JC, Bailey CA, Yokoyama K, Greene BL. Methods Enzymol. 2022;662:119-141. doi: 10.1016/bs.mie.2021.10.014. Epub 2021 Dec 7. 10.1016/bs.mie.2021.10.014 PubMed 35101207