pJEC581
(Plasmid
#174369)
-
PurposeRFP reporter used to evaluate CRISPRa in bacteria, contains gRNA target sites every 10 bp upstream of the promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174369 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSC101
- Backbone size w/o insert (bp) 3396
- Total vector size (bp) 4319
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFP with PAM rich sequence upstream promoter
-
Alt nameRed Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)926
- Promoter J23117
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acatcccggactacctgaa
- 3′ sequencing primer ctttcagtttagcggtctgg
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJesse Zalatan lab. pJF076Sa plasmid Addgene #113322
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC581 was a gift from James Chappell (Addgene plasmid # 174369 ; http://n2t.net/addgene:174369 ; RRID:Addgene_174369) -
For your References section:
Rational engineering of a modular bacterial CRISPR-Cas activation platform with expanded target range. Villegas Kcam MC, Tsong AJ, Chappell J. Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211. 10.1093/nar/gkab211 PubMed 33823546