Skip to main content

pJEC581
(Plasmid #174369)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 174369 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    SC101
  • Backbone size w/o insert (bp) 3396
  • Total vector size (bp) 4319
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RFP with PAM rich sequence upstream promoter
  • Alt name
    Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    926
  • Promoter J23117

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer acatcccggactacctgaa
  • 3′ sequencing primer ctttcagtttagcggtctgg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jesse Zalatan lab. pJF076Sa plasmid Addgene #113322

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJEC581 was a gift from James Chappell (Addgene plasmid # 174369 ; http://n2t.net/addgene:174369 ; RRID:Addgene_174369)
  • For your References section:

    Rational engineering of a modular bacterial CRISPR-Cas activation platform with expanded target range. Villegas Kcam MC, Tsong AJ, Chappell J. Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211. 10.1093/nar/gkab211 PubMed 33823546