VAMP4 KD1 mScarlet
(Plasmid
#174407)
-
Purposelentiviral vector for VAMP4 knock-down in rat cells, KD1 shRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174407 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneFHUG+W (Addgene #74011)
-
Backbone manufacturerOliver Schluter
- Total vector size (bp) 10158
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namevesicle associated membrane protein 4
-
gRNA/shRNA sequenceCTATCTTTATTTAACAACA
-
SpeciesR. norvegicus (rat)
-
Entrez GeneVamp4
- Promoter H1-Ubiquitin
-
Tag
/ Fusion Protein
- mScarlet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CTCACGGGGATTTCCAAGTCTCCACCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VAMP4 KD1 mScarlet was a gift from David Perrais (Addgene plasmid # 174407 ; http://n2t.net/addgene:174407 ; RRID:Addgene_174407) -
For your References section:
The vSNAREs VAMP2 and VAMP4 control recycling and intracellular sorting of post-synaptic receptors in neuronal dendrites. Bakr M, Jullie D, Krapivkina J, Paget-Blanc V, Bouit L, Petersen JD, Retailleau N, Breillat C, Herzog E, Choquet D, Perrais D. Cell Rep. 2021 Sep 7;36(10):109678. doi: 10.1016/j.celrep.2021.109678. 10.1016/j.celrep.2021.109678 PubMed 34496238