pAd5-Blue
(Plasmid
#174431)
-
PurposepAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174431 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAd5-Blue
- Backbone size w/o insert (bp) 35555
- Total vector size (bp) 37236
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsbest if grown in Terrific Broth best if plasmid is electroporated in DH5a/XL-1Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameβ-galactosidase α gene fragment
-
Alt namelacZ
-
SpeciesE. coli
-
Insert Size (bp)1681
-
GenBank IDMK533795.1 MK533795.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site ClaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer GCTGGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer CTCTACAAATGTGGTATGGCTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd5-Blue was a gift from Teresa De Los Santos (Addgene plasmid # 174431 ; http://n2t.net/addgene:174431 ; RRID:Addgene_174431) -
For your References section:
Adenovirus-vectored foot-and-mouth disease vaccine confers early and full protection against FMDV O1 Manisa in swine. Fernandez-Sainz I, Medina GN, Ramirez-Medina E, Koster MJ, Grubman MJ, de Los Santos T. Virology. 2017 Feb;502:123-132. doi: 10.1016/j.virol.2016.12.021. Epub 2016 Dec 28. 10.1016/j.virol.2016.12.021 PubMed 28039799