pAd5-Blue
(Plasmid #174431)

• Purpose: pAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.
• Depositing Lab: Teresa De Los Santos
• Publication: Fernandez-Sainz et al Virology. 2017 Feb;502:123-132. doi: 10.1016/j.virol.2016.12.021. Epub 2016 Dec 28.

Backbone

• Vector backbone: pAd5-Blue
• Backbone size w/o insert (bp): 35555
• Total vector size (bp): 37236
• Vector type: Mammalian Expression, Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: best if grown in Terrific Broth best if plasmid is electroporated in DH5a/XL-1Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: β-galactosidase α gene fragment
• Alt name: lacZ
• Species: E. coli
• Insert Size (bp): 1681
• GenBank ID: MK533795.1 MK533795.1
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (unknown if destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: GCTGGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CTCTACAAATGTGGTATGGCTGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry