opto-Tiam1
(Plasmid
#174508)
-
PurposeExpresses opto-Tiam1 (BcLOV4-GGGSx2-Tiam1DH-GGGSx2-mCherry) in a pcDNA3.1 backbone.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174508 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5377
- Total vector size (bp) 8644
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameopto-Tiam1-mCherry
-
SpeciesH. sapiens (human); Botrytis cinerea
-
Insert Size (bp)3267
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
opto-Tiam1 was a gift from Brian Chow (Addgene plasmid # 174508 ; http://n2t.net/addgene:174508 ; RRID:Addgene_174508) -
For your References section:
Designing Single-Component Optogenetic Membrane Recruitment Systems: The Rho-Family GTPase Signaling Toolbox. Berlew EE, Yamada K, Kuznetsov IA, Rand EA, Ochs CC, Jaber Z, Gardner KH, Chow BY. ACS Synth Biol. 2022 Jan 21;11(1):515-521. doi: 10.1021/acssynbio.1c00604. Epub 2022 Jan 3. 10.1021/acssynbio.1c00604 PubMed 34978789