pMB1_1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA)
(Plasmid
#174516)
-
PurposeRecoded double aaRS/tRNA plasmid with 1R26PylRS/AlvtRNA-ΔNPyl(8)(CGA) & AfTyrRS/AftRNA-Tyr(A01)(CUA) to incorporate CbzK into the TCG codon & p-I-Phe into the TAG codon.
-
Depositing Lab
-
Depositing OrganizationMRC Laboratory of Molecular Biology
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMB1
- Backbone size w/o insert (bp) 3068
- Total vector size (bp) 5055
-
Modifications to backboneThe whole backbone was recoded according to Syn61
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePylS_1R26 - CBZK
-
Insert Size (bp)838
-
MutationRecoded; Y126G-M129L
- Promoter GlnS
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAGGTCGTTCGCTCCAAG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAf_TyrRS - p-I-Phe
-
SpeciesA.fulgidus
-
Insert Size (bp)972
-
MutationRecoded; Y36I-L69M-H74L-Q116E-D165T-I166G
- Promoter GlnS
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGCTtccACAACCTATTTGAACGG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMa tRNA pylT(8) with CGA anticodon
-
SpeciesM. alvus
-
Insert Size (bp)72
-
MutationM.alvus Pyl tRNA with CGA anticodon
- Promoter lpp
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer atgtaggtgttccacagggtagc
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameA.fulgidus tRNA with CUA anticodon
-
SpeciesA.fulgidus
-
MutationCUA anticodon
- Promoter lpp
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer atgtaggtgttccacagggtagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB1_1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA) was a gift from Jason W Chin (Addgene plasmid # 174516 ; http://n2t.net/addgene:174516 ; RRID:Addgene_174516) -
For your References section:
Sense codon reassignment enables viral resistance and encoded polymer synthesis. Robertson WE, Funke LFH, de la Torre D, Fredens J, Elliott TS, Spinck M, Christova Y, Cervettini D, Boge FL, Liu KC, Buse S, Maslen S, Salmond GPC, Chin JW. Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029. 10.1126/science.abg3029 PubMed 34083482