pBAD_Ub11TCA
(Plasmid #174517)

• Purpose: Recoded ubiquitin reporter with TCA replacing codon 11 of wt ubiquitin
• Depositing Lab: Jason W Chin
• Publication: Robertson et al Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 3896
• Total vector size (bp): 4145
• Modifications to backbone: The entire backbone was recoded according to Syn61. AmpR gene was replaced by ApmR (apramycin)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Apramycin, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Ubiquitin
• Species: H. sapiens (human)
• Insert Size (bp): 249
• Mutation: Recoded with TCA replacing codon 11 of wt ubiquitin
• Promoter: araBAD
• Tag / Fusion Protein:
  • 6xHis (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC

Resource Information

• Supplemental Documents:
  • pBAD_Ub11TCA.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry