pMB1_MmPylRS_MmtRNA-Pyl-opt(UGA)
(Plasmid #174515)

• Purpose: Recoded single aaRS/tRNA plasmid with MmPylRS and MmtRNA-Pyl-opt with the ASL from the serT gene (UGA anticodon)
• Depositing Lab: Jason W Chin
• Publication: Robertson et al Science. 2021 Jun 4;372(6546):1057-1062. doi: 10.1126/science.abg3029.

Backbone

• Vector backbone: pMB1
• Backbone size w/o insert (bp): 3015
• Total vector size (bp): 4452
• Modifications to backbone: The entire backbone was recoded according to the genome of Syn61
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Mm PylS
• Species: M.mazei
• Insert Size (bp): 1365
• Mutation: recoded
• Promoter: GlnS

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGTGCGGACTGTTGTAACTC

Gene/Insert 2

• Gene/Insert name: MmtRNA-Pyl-opt(UGA)
• Species: M. Mazei
• Mutation: ASL from the serT gene (UGA anticodon)
• Promoter: lpp

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGTGCGGACTGTTGTAACTC

Resource Information

• Supplemental Documents:
  • pMB1_MmPylRS_MmtRNA-Pyl-opt(UGA).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry