Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Syn61
(Bacterial strain #174513)

No maps are available for this item.

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Bacterial Strain 174513 Bacteria in agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    This is a recoded E.coli strain
  • Growth instructions
    Streptomycin resistant by virtue of K43R mutation in rpsL. Grow in LB or 2xYT, 100 micrograms/mL streptomycin to maintain
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Recoded E. coli strain without TCG, TCA, or TAG codons
  • GenBank ID
    CP040347.1

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.

Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Syn61 was a gift from Jason W Chin (Addgene plasmid # 174513)
  • For your References section:

    Total synthesis of Escherichia coli with a recoded genome. Fredens J, Wang K, de la Torre D, Funke LFH, Robertson WE, Christova Y, Chia T, Schmied WH, Dunkelmann DL, Beranek V, Uttamapinant C, Llamazares AG, Elliott TS, Chin JW. Nature. 2019 May;569(7757):514-518. doi: 10.1038/s41586-019-1192-5. Epub 2019 May 15. 10.1038/s41586-019-1192-5 PubMed 31092918