cp-DdCBE G1333-N
(Plasmid
#174556)
-
PurposeChloroplast-targeting DdCBE (split DddA, G1333-N) Golden Gate destination vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep3s
- Backbone size w/o insert (bp) 4205
- Total vector size (bp) 7064
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDdCBE G1333-N
-
Alt namecpTP-3xHA-N-term-Stuffer-C-term-G1333-N-UGI
-
SpeciesLettuce, Rapeseed
-
Insert Size (bp)2853
- Promoter PcUbi
-
Tag
/ Fusion Protein
- HA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTAGCAACGATTGTACAATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cp-DdCBE G1333-N was a gift from Jin-Soo Kim (Addgene plasmid # 174556 ; http://n2t.net/addgene:174556 ; RRID:Addgene_174556) -
For your References section:
Chloroplast and mitochondrial DNA editing in plants. Kang BC, Bae SJ, Lee S, Lee JS, Kim A, Lee H, Baek G, Seo H, Kim J, Kim JS. Nat Plants. 2021 Jul;7(7):899-905. doi: 10.1038/s41477-021-00943-9. Epub 2021 Jul 1. 10.1038/s41477-021-00943-9 PubMed 34211132