pDRM18 LTN (Luciferase tdTomato Neo)
(Plasmid
#174721)
-
PurposeExpresses the firefly luciferase gene, E2A, tdTomato, P2A, and the neomycin resistance gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRRLSIN.cPPT.MND
- Backbone size w/o insert (bp) 6685
- Total vector size (bp) 10731
-
Vector typeMammalian Expression, Lentiviral, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameFirefly Luciferase
-
Alt nameLuc
-
SpeciesPhotinus pyralis
-
Insert Size (bp)1650
- Promoter MND
-
Tag
/ Fusion Protein
- E2A linker (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer MND-F (GTTCGCTTCTCGCTTCTGTT) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametdTomato
-
Alt nameTomato
-
SpeciesSynthetic
-
Insert Size (bp)1428
- Promoter MND (off Luc-E2A)
-
Tag
/ Fusion Protein
- P2A linker (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer Use Luc-F (GACGAAGTACCGAAAGGTCTT), Neo-R (GTCATAGCCGAATAGCCTCTC), and/or tdTomato Internal-R (TCTTTGATGACGGCCATGT) (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameaph
-
Alt nameAminoglycoside phosphotransferase/NeoR/KanR
-
SpeciesEscherichia coli
-
Insert Size (bp)792
-
GenBank ID
- Promoter MND (off Luc-E2A-tdTomato-P2A)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer WPRE-R (GCGTAAAAGGAGCAACATAG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRM18 LTN (Luciferase tdTomato Neo) was a gift from Wayne Tilley (Addgene plasmid # 174721 ; http://n2t.net/addgene:174721 ; RRID:Addgene_174721) -
For your References section:
Selective inhibition of CDK9 in triple negative breast cancer. Mustafa EH, Laven-Law G, Kikhtyak Z, Nguyen V, Ali S, Pace AA, Iggo R, Kebede A, Noll B, Wang S, Winter JM, Dwyer AR, Tilley WD, Hickey TE. Oncogene. 2023 Nov 24. doi: 10.1038/s41388-023-02892-3. 10.1038/s41388-023-02892-3 PubMed 38001268