eSpCas9-EF-5Nanog_2
(Plasmid
#174871)
-
PurposeCRISPR vector for generating Nanog STREAMING-tag KI cell
-
Depositing Lab
-
Depositing OrganizationHiroshima University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 174871-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 174871-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneeSpCas9(1.1)
-
Backbone manufacturerFeng Zhang
- Total vector size (bp) 8519
-
Modifications to backboneWe applied an optimized sgRNA design (sgRNA(F+E)) (Chen et al., Cell, 2013).
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for mouse Nanog
-
Alt nameNanog homeobox (Mus musculus)
-
gRNA/shRNA sequenceTGTAAGCAAGAATAGTTCTC
-
SpeciesSynthetic
-
GenBank ID
-
Entrez GeneNanog (a.k.a. 2410002E02Rik, ENK, Stm1, ecat4)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer LKO1_5_primer
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 174871-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 174871-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9-EF-5Nanog_2 was a gift from Hiroshi Ochiai (Addgene plasmid # 174871 ; http://n2t.net/addgene:174871 ; RRID:Addgene_174871) -
For your References section:
STREAMING-tag system reveals spatiotemporal relationships between transcriptional regulatory factors and transcriptional activity. Ohishi H, Shimada S, Uchino S, Li J, Sato Y, Shintani M, Owada H, Ohkawa Y, Pertsinidis A, Yamamoto T, Kimura H, Ochiai H. Nat Commun. 2022 Dec 20;13(1):7672. doi: 10.1038/s41467-022-35286-2. 10.1038/s41467-022-35286-2 PubMed 36539402
