Halo-WIPI2B H85E K88E I92E
(Plasmid
#175033)
-
PurposeExpresses WIPI2B (H85E K88E I92E) fused to Halo in mammalian cells to abrogate interaction with ATG16L1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175033 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHTN
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6143
- Total vector size (bp) 7410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameWIPI2B (H85E K88E I92E)
-
SpeciesH. sapiens (human)
-
MutationHistadine 85 to Glutamate (CAC to GAG); Lysine 88 to Glutamate (AAG to GAG); Isoleucine 92 to Glutamate (ATC to GAA)
-
Entrez GeneWIPI2 (a.k.a. ATG18B, Atg21, CGI-50, IDDSSA, WIPI-2)
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cctgatcggcagcgagatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySharon Tooze, Francis Crick Institute, UK
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Halo-WIPI2B H85E K88E I92E was a gift from Andrea Stavoe (Addgene plasmid # 175033 ; http://n2t.net/addgene:175033 ; RRID:Addgene_175033) -
For your References section:
Structural basis for membrane recruitment of ATG16L1 by WIPI2 in autophagy. Strong LM, Chang C, Riley JF, Boecker CA, Flower TG, Buffalo CZ, Ren X, Stavoe AK, Holzbaur EL, Hurley JH. Elife. 2021 Sep 10;10. pii: 70372. doi: 10.7554/eLife.70372. 10.7554/eLife.70372 PubMed 34505572