pVC-DNAJB6b
(Plasmid
#175065)
-
Purposeexpresses mVenus and mCherry tagged DNAJB6b in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175065 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA5-FRT-TO-V5
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 5088
- Total vector size (bp) 7236
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNAJB6b
-
Alt nameDnaJ homolog subfamily B member 6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2148
-
MutationmVenus: C-Terminal deletion of 11 aa (GITLGMDELYK); mCherry: C-Terminal deletion of 5 aa (DELYK) and N-Terminal deletion of 7 aa (MVSKGEE)
-
GenBank IDAAF21257.1
-
Entrez GeneDNAJB6 (a.k.a. DJ4, DnaJ, HHDJ1, HSJ-2, HSJ2, LGMD1D, LGMD1E, LGMDD1, MRJ, MSJ-1)
- Promoter CMV Promoter
-
Tags
/ Fusion Proteins
- mVenus + mCherry (N terminal on insert)
- V5 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVC-DNAJB6b was a gift from Arnold Boersma (Addgene plasmid # 175065 ; http://n2t.net/addgene:175065 ; RRID:Addgene_175065) -
For your References section:
A FRET-based method for monitoring structural transitions in protein self-organization. Wan Q, Mouton SN, Veenhoff LM, Boersma AJ. Cell Rep Methods. 2022 Mar 28;2(3):100184. doi: 10.1016/j.crmeth.2022.100184. eCollection 2022 Mar 28. 10.1016/j.crmeth.2022.100184 PubMed 35475219