Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pVC-FUS-WT
(Plasmid #175066)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175066 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5479
  • Total vector size (bp) 8478
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FUS glycine rich protein
  • Alt name
    FUS
  • Alt name
    Fus-wt
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2952
  • Mutation
    mVenus: C-Terminal deletion of 11 aa (GITLGMDELYK); mCherry: C-Terminal deletion of 5 aa (DELYK) and N-Terminal deletion of 7 aa (MVSKGEE)
  • GenBank ID
    CAA50559.1
  • Entrez Gene
    FUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
  • Promoter CMV Promoter
  • Tag / Fusion Protein
    • mVenus + mCherry (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer AAAACCTCCCACATCTCCCC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVC-FUS-WT was a gift from Arnold Boersma (Addgene plasmid # 175066 ; http://n2t.net/addgene:175066 ; RRID:Addgene_175066)
  • For your References section:

    A FRET-based method for monitoring structural transitions in protein self-organization. Wan Q, Mouton SN, Veenhoff LM, Boersma AJ. Cell Rep Methods. 2022 Mar 28;2(3):100184. doi: 10.1016/j.crmeth.2022.100184. eCollection 2022 Mar 28. 10.1016/j.crmeth.2022.100184 PubMed 35475219