pCI-neo VPS50-13Myc
(Plasmid
#175093)
-
Purpose13Myc tagged VPS50 is expressed in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNational Institute of Child Health and Human Development (NICHD)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 175093-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 175093-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5456
- Total vector size (bp) 8900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS50
-
Alt namesyndetin
-
Alt nameCCDC132
-
Alt nameVPS54L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2892
-
Entrez GeneCCDC132 (a.k.a. FLJ20097, FLJ23581, KIAA1861, MGC176659)
- Promoter CMV
-
Tag
/ Fusion Protein
- 13Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer CCACTCCCAGTTCAATTACAGCTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 175093-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 175093-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo VPS50-13Myc was a gift from Juan Bonifacino (Addgene plasmid # 175093 ; http://n2t.net/addgene:175093 ; RRID:Addgene_175093) -
For your References section:
EARP is a multisubunit tethering complex involved in endocytic recycling. Schindler C, Chen Y, Pu J, Guo X, Bonifacino JS. Nat Cell Biol. 2015 May;17(5):639-50. doi: 10.1038/ncb3129. Epub 2015 Mar 23. 10.1038/ncb3129 PubMed 25799061