Skip to main content
Addgene

pCFB8457
(Plasmid #175209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNB1u/pLIFE016
  • Backbone size w/o insert (bp) 3099
  • Vector type
    mRNA expression, injection into xenopus oocytes

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    YER039C
  • Species
    S. cerevisiae (budding yeast)
  • Promoter T7
  • Tag / Fusion Protein
    • PolyA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nt.BbvCI (not destroyed)
  • 3′ cloning site USER cloning (unknown if destroyed)
  • 5′ sequencing primer AAGGCGATTAAGTTGGGT
  • 3′ sequencing primer GTGTTCTTGAGGCTGGTTTA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Generated by USER cloning

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFB8457 was a gift from Irina Borodina (Addgene plasmid # 175209 ; http://n2t.net/addgene:175209 ; RRID:Addgene_175209)
  • For your References section:

    Deorphanizing solute carriers in Saccharomyces cerevisiae for secondary uptake of xenobiotic compounds. Moller-Hansen I, Saez-Saez J, van der Hoek SA, Dyekjaer JD, Christensen HB, Wright Muelas M, O'Hagan S, Kell DB, Borodina I. Front Microbiol. 2024 Apr 12;15:1376653. doi: 10.3389/fmicb.2024.1376653. 10.3389/fmicb.2024.1376653 PubMed 38680917