Skip to main content

BPK1520_blastR
(Plasmid #175289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175289 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    BPK1520
  • Backbone manufacturer
    Joung Lab (Addgene Plasmid #65777)
  • Backbone size (bp) 2280
  • Vector type
    Mammalian Expression, CRISPR
  • Promoter CMV/U6
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
  • 3′ sequencing primer cggagcctatggaaaaacgccag
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pSBbi-RB (Addgene #60522)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BPK1520_blastR was a gift from Ronald Cohn (Addgene plasmid # 175289 ; http://n2t.net/addgene:175289 ; RRID:Addgene_175289)