BII-ChBtW-mADAR2-short
(Plasmid
#175588)
-
Purposemammalian expression of mouse short Adar2, blasticidine selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneBII-ChBtW
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 6843
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameShort Mouse Adar2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2106
-
GenBank ID110532
- Promoter cmv
-
Tag
/ Fusion Protein
- Flag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TGCCAT CGTCTCA GGC ATGGATATAGAAGATGAAGAG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BII-ChBtW-mADAR2-short was a gift from Emanuela Felley-Bosco (Addgene plasmid # 175588 ; http://n2t.net/addgene:175588 ; RRID:Addgene_175588) -
For your References section:
Heterogeneous RNA editing and influence of ADAR2 on mesothelioma chemoresistance and the tumor microenvironment. Hariharan A, Qi W, Rehrauer H, Wu L, Ronner M, Wipplinger M, Kresoja-Rakic J, Sun S, Oton-Gonzalez L, Sculco M, Serre-Beinier V, Meiller C, Blanquart C, Fonteneau JF, Vrugt B, Ruschoff JH, Opitz I, Jean D, de Perrot M, Felley-Bosco E. Mol Oncol. 2022 Dec;16(22):3949-3974. doi: 10.1002/1878-0261.13322. Epub 2022 Oct 31. 10.1002/1878-0261.13322 PubMed 36221913