Skip to main content
Addgene

HA-Foxo1-ADA 6KR
(Plasmid #17564)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17564 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV5
  • Backbone size w/o insert (bp) 4600
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Foxo1-ADA 6kr
  • Alt name
    Foxo1
  • Alt name
    Fkhr
  • Alt name
    forkhead box O1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1700
  • Mutation
    K242, K245, K259, K262, K271 and K291 were replaced with arginine.It also contains T24A, S253D and S316A mutations.
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter CMV
  • Tags / Fusion Proteins
    • Myc (N terminal on backbone)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CMV-F; pCEP-F
  • 3′ sequencing primer hGH-pA-R (CCAGCTTGGTTCCCAATAGA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains K219R, G282R and L619P polymorphisms.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-Foxo1-ADA 6KR was a gift from Domenico Accili (Addgene plasmid # 17564 ; http://n2t.net/addgene:17564 ; RRID:Addgene_17564)
  • For your References section:

    FoxO1 protects against pancreatic beta cell failure through NeuroD and MafA induction. Kitamura YI, Kitamura T, Kruse JP, Raum JC, Stein R, Gu W, Accili D. Cell Metab. 2005 Sep . 2(3):153-63. 10.1016/j.cmet.2005.08.004 PubMed 16154098