pNUT3
              
              
                (Plasmid
                
                #175744)
              
            
            
            
          - 
            PurposeSingle-component photo-inducible (CRY2-based) nucleolus-targeting tool 3
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175744 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonemCherry-C1
 - Total vector size (bp) 6384
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namemCherry-CRY2PHR-NoLS (human nuclear factor-κB inducing kinase)
 - 
                  Alt namepNUT3
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)2334
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- mCherry
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site BspEI (unknown if destroyed)
 - 3′ cloning site XhoI (unknown if destroyed)
 - 5′ sequencing primer CMVf: CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pNUT3 was a gift from Yubin Zhou (Addgene plasmid # 175744 ; http://n2t.net/addgene:175744 ; RRID:Addgene_175744) - 
                
For your References section:
Optical control of protein delivery and partitioning in the nucleolus. Tan P, Hong T, Cai X, Li W, Huang Y, He L, Zhou Y. Nucleic Acids Res. 2022 Mar 23. pii: 6553118. doi: 10.1093/nar/gkac191. 10.1093/nar/gkac191 PubMed 35325178