pET29b-AviTag-eGFP-dspB(E184Q)-6xHis
(Plasmid
#175784)
-
PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET29b
- Backbone size w/o insert (bp) 5322
- Total vector size (bp) 7245
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDispersin B
-
Alt nameDspB
-
SpeciesAggregatibacter actinomycetemcomitans
-
Insert Size (bp)1104
-
MutationE184Q
-
GenBank IDAAP31025
- Promoter T7
-
Tags
/ Fusion Proteins
- AviTag (N terminal on insert)
- eGFP (N terminal on insert)
- Hexahistidine tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGCCTGAACGACATCTTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET29b-AviTag-eGFP-dspB(E184Q)-6xHis was a gift from Mark Nitz (Addgene plasmid # 175784 ; http://n2t.net/addgene:175784 ; RRID:Addgene_175784) -
For your References section:
An Inactive Dispersin B Probe for Monitoring PNAG Production in Biofilm Formation. Eddenden A, Kitova EN, Klassen JS, Nitz M. ACS Chem Biol. 2020 May 15;15(5):1204-1211. doi: 10.1021/acschembio.9b00907. Epub 2020 Jan 21. 10.1021/acschembio.9b00907 PubMed 31917539