Skip to main content

pET17b-yebST
(Plasmid #175804)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175804 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET17b
  • Backbone size w/o insert (bp) 3187
  • Total vector size (bp) 7073
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    yebST
  • Alt name
    letAB
  • Species
    Escherichia coli K-12
  • Insert Size (bp)
    3886
  • Mutation
    silent mutations to introduce restriction sites
  • Promoter T7
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer agaggccccaaggggttatgcta
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was cloned in the lab of Professor Ian Henderson
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET17b-yebST was a gift from Gira Bhabha & Damian Ekiert & Ian Henderson (Addgene plasmid # 175804 ; http://n2t.net/addgene:175804 ; RRID:Addgene_175804)
  • For your References section:

    MCE domain proteins: conserved inner membrane lipid-binding proteins required for outer membrane homeostasis. Isom GL, Davies NJ, Chong ZS, Bryant JA, Jamshad M, Sharif M, Cunningham AF, Knowles TJ, Chng SS, Cole JA, Henderson IR. Sci Rep. 2017 Aug 17;7(1):8608. doi: 10.1038/s41598-017-09111-6. 10.1038/s41598-017-09111-6 PubMed 28819315