Skip to main content

pU6-CApegTAPE1
(Plasmid #175809)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175809 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGG-Acceptor
  • Backbone size w/o insert (bp) 2183
  • Total vector size (bp) 2306
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AmpR
  • gRNA/shRNA sequence
    TAPE-1 (CAGGA inserting pegRNA)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gactatcatatgcttaccgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-CApegTAPE1 was a gift from Jay Shendure (Addgene plasmid # 175809)
  • For your References section:

    A time-resolved, multi-symbol molecular recorder via sequential genome editing. Choi J, Chen W, Minkina A, Chardon FM, Suiter CC, Regalado SG, Domcke S, Hamazaki N, Lee C, Martin B, Daza RM, Shendure J. Nature. 2022 Jul 6. pii: 10.1038/s41586-022-04922-8. doi: 10.1038/s41586-022-04922-8. 10.1038/s41586-022-04922-8 PubMed 35794474