pENTR4 CDS A. thaliana PARP2
(Plasmid #175810)

• Purpose: pENTR4 plasmid with CDS of Arabidopsis thaliana POLY(ADP-RIBOSE) POLYMERASE 2 (PARP2, AT4G02390.1) without stop codon for C-terminal epitope tags
• Depositing Lab: Lennart Wirthmueller
• Publication: Chen et al Front Plant Sci. 2018 Nov 1;9:1581. doi: 10.3389/fpls.2018.01581. eCollection 2018.

Backbone

• Vector backbone: pENTR4
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 2235
• Total vector size (bp): 4146
• Vector type: pENTR plasmid for Gateway cloning

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PARP2
• Alt name: AT4G02390.1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 1911
• GenBank ID: NM_116472
• Entrez Gene: PARP2 (a.k.a. AT4G02390, APP, ATPARP1, PARP1, POLY(ADP-RIBOSE) POLYMERASE, POLY(ADP-RIBOSE) POLYMERASE 1, PP, T14P8.19, T14P8_19, poly(ADP-ribose) polymerase, poly(ADP-ribose) polymerase 2)
• Promoter: none
• Tag / Fusion Protein:
  • none

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCCGCCATAAACTGCCAGG
• 3′ sequencing primer: CGTTGAATATGGCTCATAACACCC

Resource Information

• Supplemental Documents:
  • pENTR4 CDS PARP2 (no stop).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry