Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pENTR4 CDS A. thaliana PARP2
(Plasmid #175810)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 175810 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pENTR4
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 2235
  • Total vector size (bp) 4146
  • Vector type
    pENTR plasmid for Gateway cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PARP2
  • Alt name
    AT4G02390.1
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1911
  • GenBank ID
    NM_116472
  • Entrez Gene
    PARP2 (a.k.a. AT4G02390, APP, ATPARP1, PARP1, POLY(ADP-RIBOSE) POLYMERASE, POLY(ADP-RIBOSE) POLYMERASE 1, PP, T14P8.19, T14P8_19, poly(ADP-ribose) polymerase, poly(ADP-ribose) polymerase 2)
  • Promoter none
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCCGCCATAAACTGCCAGG
  • 3′ sequencing primer CGTTGAATATGGCTCATAACACCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR4 CDS A. thaliana PARP2 was a gift from Lennart Wirthmueller (Addgene plasmid # 175810 ; http://n2t.net/addgene:175810 ; RRID:Addgene_175810)
  • For your References section:

    Nuclear Import of Arabidopsis Poly(ADP-Ribose) Polymerase 2 Is Mediated by Importin-alpha and a Nuclear Localization Sequence Located Between the Predicted SAP Domains. Chen C, Masi R, Lintermann R, Wirthmueller L. Front Plant Sci. 2018 Nov 1;9:1581. doi: 10.3389/fpls.2018.01581. eCollection 2018. 10.3389/fpls.2018.01581 PubMed 30455710