OVOL2.2.2-gDNA
(Plasmid
#175877)
-
PurposeCRISPR/Cas9 plasmid to create GFP fusion proteins
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX462
-
Backbone manufactureraddgene ID: 62987
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOVOL2-Nicakse2
-
gRNA/shRNA sequenceTGTCAGCTTGCCCTGCAGAA(GGG)
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence also includes uncloned PAM
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OVOL2.2.2-gDNA was a gift from Barbara Stranger & Kevin White (Addgene plasmid # 175877 ; http://n2t.net/addgene:175877 ; RRID:Addgene_175877)